ERA’S JOURNAL OF MEDICAL RESEARCHVOL.3 NO.1
  Original Article


 NO ASSOCIATION BETWEEN GSTT1/M1 POLYMORPHISM IN GLUTATHIONE S–

TRANSFERASE (GST)GENE WITH CATARACT IN HYPERTENSIVE PATIENTS 

                                FROM NORTH INDIA

 
        Saliha Rizvi, Syed Tasleem Raza, Luxmi Singh*, Shania Abbas & Farzana Mahdi                     
                          Department of Biochemistry & Opthalmology*
                    Era's Lucknow Medical College and Hospital, Lucknow.

ABSTRACT
Age–related cataract has globally emerged as the leading cause visual 
                                                                    Address for correspondence 
impairment leading to blindness. Glutathione S–Transferases and their 
genetic variantsplay an important role in pathogenesis of cataract. This 
                                                                    Syed Tasleem Raza
case–control study was carried out to investigate possible association of 
                                                                  Department of Biochemistry 
GSTT1/M1 polymorphism with Cataract risk in North Indians. Our study 
                                                              Era's Lucknow Medical College and 
included 221 individuals, 132 as Cataract cases (70 with and 62 without 
                                                                Hospital, Lucknow, India–226003.
hypertension) and 89 age and ethnicity matched controls.  Genetic 
                                                            Ph +91 522 2408122, 2408123 Fax: +91 
polymorphism in GST gene (GSTT1/M1 polymorphism) wasevaluated by 
                                                                        5222407824 
multiplexPolymerase Chain Reaction (PCR) technique.The frequencies 
                                                                Email: tasleem24@gmail.com 
of the GSTM1–positive and GSTT1–positive in hypertensive cataract cases 
were 55.71%, 92.86%; while they were 61.29% and 95.16% in cataract 
cases without hypertension and; 46.07% and 97.75% in healthy controls 
respectively. The frequencies of GSTM1–null and GSTT1–null in hypertensive cataract cases were 44.29% and 7.14% 
%; while they were 38.71% and 4.84% in cataract cases without hypertension and; 53.93% and 2.25% in healthy 
controls respectively. The frequency of GSTT1/M1 positive wild type genotype was 48.57% in hypertensive and 
56.45% in normotensive cataract cases while it was 43.82% in control subjects. Our study found no association 
between GSTT1/M1 polymorphism with cataract but a nearly significant relationship was observed in GSTM1 
positive and GSTM1 null genotypes (p=0.065) with cataract in subjects without hypertension. The study needs 
furtherinvestigation due to limited sample size. 

Key words: Cataract, Genetic polymorphism, GST, GSTT1/M1, Oxidative stress.

                                                in the lens also lead to development of cataract.(7) 
INTRODUCTION
                                                There are many cellular defense mechanisms that 
Cataract is one of the most common causes of visual 
                                                protect the human lens from oxidative damage. The 
impairment and blindness all over the world. Cataract 
                                                glutathione S–transferase (GST) is one of the 
develops slowly with time and eventually leads to 
                                                detoxification enzyme systems and plays important 
impairment of vision. Age–related cataract makes up80% 
                                                role in inactivating endogenous and exogenous toxic 
of all the cataract cases occurring globally. It is 
                                                products under oxidative stress. Human GSTs divided 
characterized by formation of a dense, cloudy area in the 
                                                into different classes; including mu, theta and omega.  
lens of the eye due to accumulation of protein clumps that 
                                                Among the various polymorphic variants of GST genes, 
prevents the lens from sending clear images to the 
                                                GSTM1/T1 polymorphisms are the most common and 
retina.Cataract is said to havea multifactorial origin 
                                                they were found to be significantly associated with 
where various environmental and genetic factors 
                                                various diseases, such as type 2 diabetes mellitus, 
contribute to its progression and development.(1)A lot of 
                                                  (8)cataract,(9) rheumatoid arthritis (10), age–related 
epidemiologic studies have been conducted globally to 
                                                macular degeneration etc.(11)Although several 
understand the pathogenesis of cataract  and many of 
                                                plausible mechanisms have been proposed based on 
these studies have indicated that hypertension plays an 
                                                laboratory results, the conclusions from epidemiologic 
important role in the development of cataract.(2–5) It was 
                                                studies remain inconsistent to find out an exact 
reported from a study that hypertension might lead to 
          EJMR
                                                relationship between cataract and GST polymorphisms. 
conformational alteration of the structure of proteins 
                                                Thus, this study is aimed to investigate the association 
present in lens capsule ,(6) and it may also lead to cataract 
                                                of GSTT1/M1 polymorphism in GST gene with cataract 
development through intense systemic inflammation 
                                                among a selected group of hypertensive North Indians.
which is causative of cataract. Apart from this, studies 
have shown that oxidative stress resulting from increase 
in production of reactive oxygen species and free radicals 


                                            5 NO ASSOCIATION BETWEEN GSTT1/M1 POLYMORPHISM IN GLUTATHIONE S–TRANSFERASE (GST)GENE WITH CATARACT IN HYPERTENSIVE PATIENTS FROM NORTH INDIA.



                                                for one minute, 64 °C for one minute,72 °C for one 
MATERIALS AND METHODS
                                                minute and a final extension of 72 °C forseven minutes. 
Patient's selection
                                                Amplified products were separated ona 1.5% agarose gel 
Blood samples of 132cataract patients and 89 healthy 
                                                stained with 0.5 μg/mL of ethidiumbromide and 
controls were collected from the Departmentof 
                                                visualised using a bioimaging and Geldocumentation 
Ophthalmology of Era's Lucknow Medical College & 
                                                system (UVP LLC).                 . 
Hospital, Lucknow. Data collection was done for each 
                                                Statistical Analysis
patient on clinical variables including age, alcohol 
                                                  Statistical analysis was performed using the Statistical 
consumption, body mass index, height, weight, 
                                                Package for the Social Sciences (SPSS), Version12 
cigarettes smoking, family history etc. All subjects 
                                                (IBM Corp., Chicago, Illinois, USA). Variables were 
with senile cataract had visual disturbance and their 
                                                tested for normality using the Kolmogorov–Smirnov 
corrected visual acuities were under 6/24. A diagnosis 
                                                test. Variables with a normal distribution were 
of hypertension was based on sustained diastolic blood 
                                                  expressed as means ± standard deviation while 
pressure of >90mmHg and systolic blood pressure of 
                                                variables with a non–normal distribution were 
>140 mm Hg. We excluded patients with secondary 
                                                  expressed as medians and inter quartile ranges and 
cataract due to diabetes, trauma, steroid 
                                                were log transformed before statistical analysis. AChi–
administration, and other causes. Age and ethnicity 
                                                squared test was used to compare geno typing data 
matched control subjects were collected from 
                                                between cases and controls. A P value of ≤0.050was 
unrelated volunteers inthe same clinic. Informed 
                                                considered significant. The odds ratio (OR) and 95% 
consent was obtained from each subject prior to 
                                                confidence interval (CI) was calculated to test the 
sample collection and Institutional Ethical clearance 
                                                relative risk for association. Other variables were 
was obtained for executing this work, earlier to the 
                                                  compared using the Student's t–test for normally 
recruitment of subjects in this study.
                                                distributed variables.
DNA Extraction
                                                  RESULTS
Venous blood (4 ml) was collected from all the 
                                                Our study included 221 individuals, 132 as Cataract 
subjects in 0.5 M vacutainers with EDTA as 
                                                cases (70 with and 62 without hypertension) and 89 
anticoagulant for DNA extraction and biochemical 
                                                age and ethnicity matched controls. Clinical and 
analysis. Genomic DNA was isolated from whole 
                                                  biochemical parameters of cases and controls are 
blood using DNA extraction kit (MACHEREY–
                                                shown in Table 1.In GST genetic polymorphisms, the 
NAGE, Germany) following manufacturers protocol. 
                                                band sizes observed were 215 bp, 480 bp and 268 bp 
he DNA concentration was determined by 
                                                for GSTM1, GSTT1 and β–globin respectively (Figure 
aNanodrop 2000 spectrophotometer (Thermo Fisher 
                                                1). Negligible discrepancy in genotyping was 
Scientific) and samples were stored at –20 °C.
                                                observed.
Genetic polymorphism Analysis
The GSTM1 and GSTT1 genetic polymorphisms were 
analysed by genomic DNA amplificationusing the 
multiplex–PCR technique (MJ Mini™Thermal Cycler, 
Bio Rad Laboratories Inc., Hercules,California, 
 USA). Primers for GSTM1were5'AACTCCCTGAAAA
GCTAAAGC–3' and 5'–GTTGGGCTCAAATATACG
GTGG–3', while primers for GSTT1 were–
5'TTCCTTACTGGTCCTCACATCTC3’
                              (12)
and 5'–TCACCGGACTGGCCAGCA–3'. Toavoid 
false–negative readings, β–globin was usedas an internal 
 
control. Primers for β–globin were5'–
CAACTTCATCCACGTTCACC–3' and 5'–
                                                Fig. 1: 2%Agarose gel image showing PCR products of 
GAAGAGCCAAGGACAGGTAC–3'. PCR 
                                                  glutathione S–transferase (GST) gene polymorphisms. 
amplificationwas conducted in a total volume of 25 μL 
          EJMR
                                                The presence or absence of GSTM1 and 
using:10 pmol of each primer; 100 ng of genomic 
                                                  GSTT1genotype was detected by 480 base pairs (bp) 
DNA;2.5 mmol/L of magnesium chloride; 0.2 
                                                and 210 bp bands, respectively. β–globin was considered 
mmol/Leach of deoxyribonucleotide triphosphate; and 1 
                                                an internal control at 260 bp. Lane 1 (L1) shows β–
Uof Taq polymerase (Bioline Reagents Ltd). ThePCR 
                                                globingene, Lane 2 (L2) shows GSTM1 null genotype, 
amplification was performed using an initialdenaturation 
                                                and Lanes3,5–8 (L3, L5– L8) showsGSTM1 and GSTT1 
at 94 °C for five minutes, followed by 30cycles at 94 °C 
                                                wild–type genotypes. Lane 4 is a 100 bp ladder. 


                                            6 2016ERA’S JOURNAL OF MEDICAL RESEARCHVOL.3 NO.1Jan–Jun



                                                confirmed significant association between GSTM1 null 
GSTT1/M1 polymorphism Analysis
                                                genotype frequency with cataract risk wherethe 
The GSTM1–null genotype frequency was 53.93% in 
                                                frequency of GSTM1 null genotype was found to be 
healthy controls which was higher than the frequency in 
                                                33.01% (p=0.003) which is similar to results from our 
cataract cases with hypertension (44.29%) (OR = 0.68; 
                2
                                                finding where we found a nearly significant association 
95% CI = 0.36–1.27; x = 1.46; power = 0.227) and 
                                              of GSTM1 null genotype in our cataract cases without 
nearly significantly higher than cataract cases without 
                                                hypertension (38.71%; p=0.065) however this 
hypertension (38.71%)(OR = 0.54; 95% CI = 0.28–1.04; 
2
                                                frequency was lower when compared to Chinese 
x = 3.39; power = 0.065). The frequency of the GSTT1–
                                                population (52.4%). In our study GSTM1 positive 
null genotype was 7.14% (OR = 3.35; 95% CI = 0.63–
  2
                                                genotype was not found to be associated with risk of 
17.79; x = 2.23; power = 0.135) among hypertensive 
                                                cataract in hyperetensive cases (p=0.227) which is 
cataract cases as and 4.84% (OR = 2.21; 95% CI = 
      2
                                                contradictory to findings from Estonian (16) Iranian 
0.36–13.64; x = 0.76; power = 0.381) among the 
                                              (17), Chinese (18) and Egyptianpopulations.(19) 
normotensive cataract cases as compared to 2.25% in 
                                                However the frequency of GSTM1 positive genotype in 
healthy controls, respectively.The frequencies of 
                                              our cataract cases without hypertension which was 
GSTM1 and GSTT1 positive genotypes were 55.71 % 
                                              found to be nearly significant (61.29%; p=0.065) was 
and 92.86% (OR = 1.47 and 0.3; 95% CI = 0.78–2.76 and 
    2
                                              similar to its frequency in another study from north India 
0.06–1.59; x = 1.46 and 2.23; power = 0.227 and 0.135 
                                                (62.13%) where it was found to be significantly 
respectively) in hypertensive cataract cases, while they 
                                                associated with risk of cataract (p=0.025).(9) Similarly 
were 61.29% and 95.16% (OR = 1.85 and 0.45; 95% CI 
                    2
                                                  frequency of GSTT1/M1 wild type genotype was 
= 0.96–3.58 and 0.07–2.79; x = 3.39 and 0.77; power = 
                                                56.45% in our cataract cases without hypertension 
0.065 and 0.381) in normotensive cataract caseswhile 
                                                which is similar to results from north Indian study where 
the frequencuies of GSTM1 and GSTT1 positive 
                                              it was found to be 53.39%.(9) Our study showed no 
genotypes were 46.07% and 97.75% in the control 
                                                significant association between GSTT1 null genotype 
group, respectively.The frequency of GSTT1/M1 
                                                with cataract in both hypertensive and normotensive 
genotype was 43.82% in controls which was somewhat 
                                                cases (p=0.135, p=0.38 respectively) which is similar to 
less than the frequency observed in cataract patients 
                                                results from Iranian (17) Turkish (20),Estonian (16) and 
with hypertension (48.57%)(OR = 1.21; 95% CI = 0.66–
2
                                                Chinese populations.(18) The frequency of 
2.27; x = 0.36; power = 0.551). However, the frequency 
                                                GSTT1positive genotype in our study was found to be 
of GSTT1/M1 genotype in cataract cases without 
                                                92.86% and 95.16% in hyperetensive and normotensive 
hypertension was comparatively higher (56.45%) (OR 
                    2
                                                cataract cases respectively which was higher than the 
= 1.66; 95% CI = 0.86–3.20; x = 2.33; power = 0.127) 
                                                frequencies observed in other studies from north India 
than controls (43.82%). Data shown in Table 2.
                                                (86.40%),(9) Iran (73.65%) (17) and Estonian 
                                                population (85.5%).(16)
DISCUSSION
Oxidative stress is a major factor involved in various 
                                              On comparing the genotype frequencies of GSTT1/M1 
processes resulting in degradation of lens protein 
                                                polymorphism among hypertensive and normotensive 
involved in cataractogenesis ultimately leading to the 
                                                cataract cases the results were found to be insignificant. 
development of age–related cataract.This cellular 
                                                However, the frequencies were found to be quite 
damage was found to be further alleviated by the cellular 
                                                different among both the groups where the frequency of 
defense mechanisms involving GST enzymes which 
                                                GSTT1/M1 positive genotype was 48.57% in 
play a major role in cell detoxification. Various 
                                                hypertensive cases and 56.45% in normotensive cases. 
polymorphisms in GST gene have now beenconsidered 
                                                Similarly, the frequencies of GSTM1 positive and 
as risk factors for age–related cataracts, but the results 
                                                GSTM1null genotypes were 55.71% and 44.29% in 
still remain controversial when comparing different 
                                                hypertensive cataract cases respectively which was quite 
ethnic groups. (12)
                                                different from the frequencies observed in cataract cases 
                                                without hypertension (61.29% and 38.71% respectively) 
Sekine and colleagues in 1995 reported for the first time 
                                              There are many factors which might contribute to the 
that GSTM1 null genotype was associated with cataract 
                                                disparities in the results of various genetic 
risk (13). Recently this result was confirmed by a meta–
          EJMR
                                                polymorphism studies and these limitations also inherent 
analysis in Asians (14) however, another meta–analysis 
                                              to our study like the number of study subjects.(20) 
after including one more study on Asians (15) did not 
confirm this associationthus the results have been very 
inconsistent. However a study from north India 




                                            7 NO ASSOCIATION BETWEEN GSTT1/M1 POLYMORPHISM IN GLUTATHIONE S–TRANSFERASE (GST)GENE WITH CATARACT IN HYPERTENSIVE PATIENTS FROM NORTH INDIA.





Table 2: Comparison of frequencies of Glutathione S–Transferase (GST) genetic polymorphisms 

among hypertensive and normotensive Cataract cases with healthy controls(n= 221) 


                                  Cataract with 
       Control (n=89) Hypertension 
  
                                      (n=70) 
                                                                                  Bonferroni 
 Genotype/ Frequency Frequency p 
                                                                    c2
                n n OR 95% CI  corrected 
    Allele (%) (%) values 
                                                                                  p values 

GSTT1–positive, 
                39 43.82 34 48.57 1.21
                                                     0.66–2.27 0.36 0.551 0.551 
GSTM1–positive 

  GSTT1–null 
                2 2.25 5 7.14 3.35 0.63–17.79 2.23 0.135 0.135 

GSTM1–positive 
                41 46.07 39 55.71 1.47 0.78–2.76 1.46 0.227 0.227 

GSTT1 –Positive 
                87 97.75 65 92.86 0.3 0.06–1.59 2.23 0.135 0.135 

GSTM1–null 
                48 53.93 31 44.29 0.68 0.36–1.27 1.46 0.227 0.227 


 
                                    Cataract 
                                    without 
                Control (n=89)   
       hypertension 
                                      (n=62) 
                                                                                  Bonferroni 
 Genotype/ p 
                                                                    c2
                n Frequency n Frequency OR 95% CI  corrected 
    Allele values 
                                                                                  p values 
GSTT1–positive, 
                39 43.82 35 56.45 1.66
                                                     0.86–3.20 2.33 0.127 0.127 
GSTM1–positive 

                                                  2.21 0.36–13.64 0.76 0.381 0.381 
  GSTT1–null 
                2 2.25 3 4.84 

                                                     0.96–3.58 3.39 0.065 
                                                  1.85
GSTM1–positive 0.065 
                41 46.07 38 61.29 

                                                                                    0.381 
GSTT1 –Positive 
                87 97.75 59 95.16 0.45 0.07–2.79 0.77 0.381 

                                                                                    0.065 
GSTM1–null 
                48 53.93 24 38.71 0.54
                                                     0.28–1.04 3.39 
                                                                          0.065 

 
                    Cataract 
                                  Cataract with 
                    without 
                                    Hypertension 
       hypertension 
                                      (n=70) 
  
                    (n=62)  
                                                                                  Bonferroni 
                      Frequency Frequency p 
                                                                    c2
 Genotype/Allele n n OR 95% CI  corrected 
                        (%) (%) values 
                                                                                  p values 

GSTT1–positive, 
                35 56.45 34 48.57 0.73
                                                     0.37–1.45 0.82 0.366 0.366 
GSTM1–positive 
          EJMR
                                                     0.35–6.61 0.31 0.58 0.580 
                                                  1.51
  GSTT1–null 
                3 4.84 5 7.14 

                                                  0.79
                                                     0.40–1.59 0.42 0.517 0.517 
GSTM1–positive 
                38 61.29 39 55.71 

                                                  0.66 0.15–2.89 0.31 0.58 0.580 
GSTT1 –Positive 
                59 95.16 65 92.86 

                                                     0.63–2.52 0.42 0.517 0.517 
                                                  1.26
GSTM1–null 
                24 38.71 31 44.29 

  


                                            8 2016ERA’S JOURNAL OF MEDICAL RESEARCHVOL.3 NO.1Jan–Jun


                                                        Genet2016;37(1);19–24. 
recruited; the sub categorization of study subjects and 
inclusion and exclusion of various clinical and lifestyle 
                                              10. Ji JD and LeeWJ. Association between the 
factors.
                                                        polymorphisms of glutathione S–transferase genes 
                                                      and rheumatoid arthritis: a meta–analysis. Gene. 
CONCLUSION
                                                        2013;521(1);155–159.
Our study shows no significant association of GSTT1/M1 
polymorphism with hypertensive cataract patients from 
                                              11. Güven M, Görgün E, Ünal M et al. Glutathione S–
North India. However, due to small sample size we suggest 
                                                      transferase M1, GSTT1 and GSTP1 genetic 
that further epidemiologic studies on a much larger sample 
                                                        polymorphisms and the risk of age–related macular 
size are needed to test the validity of our study.
                                                      degeneration. Ophthalmic Research. 2011;46(1); 
                                                      31–37.
CONFLICT OF INTEREST
                                              12. Rizvi S, Raza ST, Siddiqi Z, Abbas S and Mahdi F. 
The authors declare no conflict of interest
                                                      Association of Angiotensin–Converting Enzyme 
                                                      and Glutathione S–Transferase Gene 
ACKNOWLEDGMENT
                                                      Polymorphisms with Body Mass Index among 
We are thankful for the study that was supported by 
                                                      Hypertensive North Indians. Sultan Qaboos Univ 
intramural grant from the Era's Lucknow Medical College 
                                                      Med J. 2015;15(4);e477–e485.
and Hospital, Lucknow, Uttar Pradesh, India.
                                              13. Sekine Y, Hommura S, Harada S. Frequency of 
                                                        glutathione–S–transferase 1 gene deletion and its 
REFERENCES
                                                      possible correlation with cataract formation. Exp 
1. Shiels A, Hejtmancik JF. Genetic origins of cataract. 
                                                      Eye Res. 1995;(60);159–163. 
Arch Ophthalmol. 2007; (125),165–73. 
                                              14. Sun L, Xi B, Yu L, Gao XC, Shi DJ, Yan YK, et al. 
2. Tsai SY, Hsu WM, Cheng CY, Liu JH, Chou 
                                                      Association of glutathione S–transferases 
  P.Epidemiologic study of age–related cataracts 
                                                        polymorphisms (GSTM1 and GSTT1) with senile 
among an elderly Chinese population in Shih–Pai, 
                                                      cataract: a meta–analysis. Invest Ophthalmol Vis 
Taiwan. Ophthalmology. 2003;(110);1089–1095.
                                                      Sci. 2010;(51);6381–6386.
3. Shah SP, Dineen B, Jadoon Z, Bourne R, Khan 
                                              15. Sun W, Su L, Sheng Y, Shen Y and Chen G. Is there 
MA.Lens Opacities in Adults in Pakistan: 
                                                      association between Glutathione S Transferases 
prevalence and risk factors. Ophthalmic 
                                                        polymorphisms and cataract risk: a meta–analysis? 
Epidemiology. 2007;(14);381–389.
                                                      BMC Ophthalmol. 2015;(15);84.
4. Rim TH, Kim MH, Kim WC, Kim TI, Kim 
                                              16. Juronen E, Tasa G, Veromann S, et al. Polymorphic 
EK.Cataract subtype risk factors identified from the 
                                                      glutathione S–transferases as genetic risk factors 
Korea National Health and Nutrition Examination 
                                                      for senile cortical cataract in Estonians. Invest 
survey 2008–2010. BMC Ophthalmol. 2014;(14);4.
                                                      Ophthalmol Vis Sci. 2000;(41);2262–2267.
5. Mukesh BN, Le A, Dimitrov PN, Ahmed S, Taylor 
                                              17. Saadat I, Ahmadi Z, Farvardin–Jahromi M, Saadat 
HR, et al. Development of cataract and associated 
                                                      M. Association between cataract and genetic 
risk factors. Arch Ophthalmol. 2006;(12);4 79–85.
                                                        polymorphisms of GSTM1, GSTT1, and GSTO2 
                                                      with respect of work place. Mol Vis. 2012;(18); 
6. Lee SM, Lin SY, Li MJ, Liang RC.Possible 
                                                      1996–2000.
  mechanism of exacerbating cataract formation in 
  cataractous human lens capsules induced by 
                                              18. Jiang Z, Liang K, Zhang Q, Tao L.Glutathione       
  systemic hypertension or glaucoma. Ophthalmic 
                                                      S–transferases polymorphisms confer 
Res. 1997;(29);83–90.
                                                      susceptibility to senile cortical cataract in the Han 
                                                      Chinese population. Mol Vis. 2012;(18); 
7.  Ottonello S, Foroni C, Carta A, Petrucco S, Maraini 
                                                      1247–1252.
G. Oxidative stress and age–related 
    cataract.Ophthalmologica. 2000;(214),78–85.
                                              19. Abdel Azeem AA, Mahmoud AA, Salaheldine 
                                                      MM, Amr K. Implication of glutathione S–
8. Raza ST, Abbas S, Ahmad F, Ahmed ZH Zaidi and 
                                                      transferase M1 and T1 polymorphisms in the 
  Mahdi F .Association of Glutathione–S–
                                                      development of senile cataract among 
  Transferase (GSTM1 and GSTT1) and FTO Gene 
          EJMR
                                                      Egyptians. .Bratisl Lek Listy. 2009;110(11); 
  Polymorphisms with Type 2 Diabetes Mellitus 
                                                      678–83.
  Cases in Northern India. Balkan J Med Genet. 
    2014;17(1);47–54
                                              20.    Gűven M, Unal M, Sarici A, et al. Glutathione–S–
                                                      transferase M1 and T1 genetic polymorphisms 
9.  Chandra A, Raza ST, Abbas S, Singh L, Rizvi S, 
                                                      and the risk of cataract development: a study in 
  Ahmed F, Eba A et al. Polymorphism of GST and 
                                                      the Turkish population. Curr Eye Res. 2007; 
  FTO Genes in Risk Prediction of Cataract among a 
                                                      (32);447–454.
  North Indian Population. Ophthalmic 

                                            9